The Role of Micro and Macro Factors In Business Decision Making Essay

The Role of Micro and Macro Factors In Business Decision Making - Essay Example This paper illustrates that economics enables firm’s in making the decision related to the production such as infrastructure and input cost, number of units, number of labor and their wages, and utility expenses, etc. are in a way to meet the market demand profitably. Additionally, the pricing decisions with profit margins are conducted on the basis of the competitive landscape of the business. All these plays defining a role in the future revenue stream for the business. Also, economics enables firm’s in making the decision-related to the production such as infrastructure and input cost, number of units, number of labor and their wages, and utility expenses, etc. are in a way to meet the market demand profitably. Additionally, the pricing decisions with profit margins are conducted on the basis of the competitive landscape of the business. All these are critical to maintaining the economic objective of achieving profitability for the firm. In addition to this, a manufa cturing concern like other businesses is also required to understand the macroeconomic factors. For example, government policies in the UK are attractive for local and international wind energy producers. These investments have the role in generating employment. The unemployment level and labor policy of the government will determine the cost of labor for the business (both skilled and unskilled). It also has an impact in determining the future demand for the business product. UK government has also lowered taxation to attract investors in the energy sector. In addition to these fiscal and monetary policy implications, GDP of the economy that determines the purchasing power of the people, etc. Also, the international trade regulations and policies of the country are also important to understand in case the input is imported from abroad or is to be exported to other countries. Hence, business economic play a guiding role in surviving and running and business successfully.

Capstone Essay Example | Topics and Well Written Essays - 2000 words - 8

Capstone - Essay Example This paper also provides information concerning the ethical values of the company, and how it affects the organizations bottom line. Northrop Grumman is an American Multi-national company, specializing in the production of defense and aerospace facilities/ products. The company began its operations in 1994, through an acquisition of Northrop by Grumman. As of the year 2010, this company was voted as the fourth largest defense contractor in the world, and it employs more than 68,000 employees all over the world. The mission of the company is to be a leader in the production of defense and aeronautical technology. The mission of the company is also to satisfy the various needs of its customers through delivery and innovating high quality technological products, which are affordable (Hayden, Campbell and Cummins, 2010). The vision of the company on the other hand is to be a trusted and reliable supplier and producer of technologies and systems capable of protecting the country. To achieve this objective, the company aims to observe ethical values that guide defense contracting, promote innovation and collaboration a mongst its employees and key stakeholders. The key stakeholders of Northrop Grumman are share holders, suppliers, employees, and the company’s customers, which are always security institutions of America, and American allies. These people have an impact on the general performance of the company; this is because the company aims at achieving profitability for purposes of satisfying its shareholders and customers (Hayden, Campbell and Cummins, 2010). The company also seeks to produce high quality defense technologies, for purposes of protecting the country and satisfying the needs of its customers. Production of high quality defense technology is part and parcel of the organization’s mission and vision, and hence the employees of the

Corporate Social Responsibility Essay Example | Topics and Well Written Essays - 1000 words - 1

Corporate Social Responsibility - Essay Example I have to admit that my knowledge about ethics prior to the course was limited. I only knew it was important and my understanding was limited to generalize idea such as â€Å"we should always strive for the right thing to do† and being ethical is always desirable. I came to the realization that ethics was important because I was aware that the recent financial crisis that rocked the world that made lives difficult for everybody was rooted in greed and lack of ethical practice in business. This explains why I chose to write about this topic because the exercise affords me the opportunity to examine the ethical aspect of business which is often neglected. I believed that this is important to learn especially when we are still in the academe and still in the process of equipping ourselves the necessary skills and knowledge so that it will be ingrained within us to become better professionals in the future. The lessons that we will learn would guide us when we make our choices in any ethical dilemma that we would confront, and would run business organisations in a corporate responsible manner. I believe that given the recent scandals that rocked the business and financial world, it now becomes an imperative that each individual entering into the corporate and financial industry must have a strong sense of corporate social responsibility or accounting to avoid similar occurrences in the future. It should begin right in the academe where future professionals, employees or entrepreneurs are being trained and prepared. It is now important because the neglect and disregard for ethical practice in business has contributed to the recent financial and mortgage breakdown that stemmed from greed and lack of ethical practice that made life difficult for everybody. The high incidence of unethical practices in modern business has prompted a stream of organizational research about morality in business1. In fact, industry experts such as Ernst & Young has pointed out that unethical business practice is the main culprit that precipitated the recent economic crisis which caused a lot of jobs and homes to be lost that made life difficult for everybody which is why it is now an imperative not only to integrate but also to stress corporate responsibility and audit beginning in the academe when future business professionals are being trained and prepared. The obvious disregard about proper corporate conduct is not surprising as Crane and Matten hypothesized that business in itself has been argued to be amoral that to put ethics in business is an oxymoron because they contradict each other2. Business in pursuit of its profit motive will invariably set aside ethics as it endeavour to make profit. Actions which may be considered unethical such as lying and deception may even become permissible in the business’ pursuit for profit3. This is consistent with the consequential normative ethic theory that â€Å"holds that the moral rightness of acts, which holds that whether an act is morally right, depends only on the consequences of that act or of something related to that act, such as the motive behind the act or a general rule requiring acts of the same kind4†. In plain language, a business person may be prompted to choose a certain course of action or inaction based on the benefit or the avoidance of harm that may be derived from such action or inaction. In the case of business, it can chose to shun any propriety in conducting business with the idea that it is more expedient to make profit by disregarding scruples in conducting its operation. Having corporate responsibility does not mean that a business organisation is already shunning the importance of profit. Profit is equally important for without it, business

Policy Alternatives Essay Example | Topics and Well Written Essays - 500 words

Policy Alternatives - Essay Example Due to the financial effects that are projected in the future, the current administration came up with a suggestion that the retirees of the defense department should cater for health care services instead of being provided for free. The government gave a proposal of the retirees paying about $200 per annum towards their health care. As per the calculation of the administration, the country will save approximately $6.7 billion. The other proposal that was also given said that soldiers are supposed to pay into a retirement plan instead of a pension plan (NPR.org, 2011). This shift of perspective will contribute in cutting down the expenses of the defense department. The impacts of this cut are, for instance, the impact of retirees paying $200 per year towards their medical care will save around $6.7 billion for the state. On the other hand, these proposals were not received with acceptance by the defense department. For instance, the protection of military benefits should not in any case undercut the military’s capability to fight and win the war. Despite the impacts, the cuts of the military benefits are seen to be very effective in achieving the goals of the administration. For example, the cutting of health care benefits seems to be effective in that the country will save around $6.7 billion per year (NPR.org, 2011). The paying of soldiers towards their retirement plan instead of the pension plan, will contribute a lot to the reduction of military benefits. The reduction of the military retirement benefits is very effective in the fact that it will assist the country to reduce the expenses towards the defense department (Washington Post, 2015). It will reduce the risk of the country becoming unable to pay the troops in the near future. From the text, it is evident that military retirement benefits cost the Pentagon around $50 billion per year. The expense is more than the

Comparison Essay Example | Topics and Well Written Essays - 2000 words

Comparison - Essay Example The coldest region of the Northeastern US still did not break records of the previous record low temperatures which the region went through in the winters of 1986. Thus the claim made by the critics of global warming is not rational. (NCDC, Climate of 2004, 2004). On the other hand, the heat waves observed in Europe were record breaking of the highest temperatures ever experienced. A divided hypothesis has been created regarding the effects of global warming and if global warming is a myth or a reality. This assignment would further revolve around this issue and give views as to which side of the scientists comes up with a strong hypothesis regarding global warming. In short, this paper is aimed at answering if the Global Warming Skepticism just smoke and mirrors? DISCUSSION "All across the world, in every kind of environment and region known to man, increasingly dangerous weather patterns and devastating storms are abruptly putting an end to the long-running debate over whether or n ot climate change is real. Not only is it real, it's here, and its effects are giving rise to a frighteningly new global phenomenon: the man-made natural disaster" (Barak Obama). There are two differing views about the existence and causes of Global Warming. One group usually links it to the actions committed by the human beings themselves. However others strongly believe that nature plays a role in creating the problem of global warming (Abrahamson, 1989). The arguments presented by both groups carry importance and without any doubt, these arguments are leading to more and more researches which are beneficial for knowledge and new theories. The study of Earth and its climate is of immense importance and beyond any doubt the reason for such extreme climatic changes should be known. In order to evaluate the reasons behind the changing climate of the Earth, the studies regarding global warming and the arguments against it are helpful. Regardless of all the arguments presented, I belie ve that humans contribute to the climatic changes and extreme weather conditions. The increased CO2 levels and rising temperature do have a link. The link between greenhouse effect and global warming are valid as put down by one set of the researchers. Although the studies and climatic researches are not invalid and the continuous debate over this topic does carry an important place in the Earth’s study. According to my point of view, it is not valid to judge the climatic change just by examining or considering the weather patterns of a small region. Global warming does not talk about a particular region, city or country. It is an overall analysis of the Earth’s temperature. Hence, claims that are based on the study of a single region are invalid and must not be relied upon. The study of NCDC, however, clearly asserts against that claim by ranking the temperature for January 2004 as the 4th warmest on record (NCDC, Climate of 2004, 2004). This further disproves the cla im of the other group. I also agree with the statement that carbon emissions are of the major cause of the problem of Global Warming. The factories which are using the fossil fuels during their manufacturing process are giving out a huge amount of carbon and this contributes greatly in making the climate warmer (CBO, 1990). The trees planted

Determination of Ka for a weak Acdi Essay Example for Free

Determination of Ka for a weak Acdi Essay In the experiment preformed the objective is to titrate a weak acid with a strong base. In a titration of a weak acid with a strong base the titrant is the strong base and the analyte is a weak acid. The reaction that will occur is the direct transfer of protons from the weak acid to the hydroxide ion. The data gathered will be represented on the titration curve, a graph of the volume of titrant being the strong base plotted against the pH . The pH is an indicator of an acids strength. The titration curve can be used to determine the pKa. By reading the graph the equivalence point can be found; which is the point where equal parts acid and base have reacted by knowing this the half-equivalence can be found pH=pKa. Procedure In the experiment pH paper will be used instead of a pH meter. The pH will be determined at the beginning and the end of the titration and the data table will be used to calculate the intermediate values. A burette is a more accurate piece of glassware used to deliver the titrate; in the lab being performed disposable pipet will be used making it very important to consistently dispense the same size drops. Before the titration the volume of a drop must be determined. A pipet is completely fill with distilled water. The average number of drops in a mL and the average quantity of a mL represented by on drop is calculated and recorded. Water is added drop by drop to a graduated cylinder from a pipet at the first, second and third mL lines the water drops are recorded. The average number of drops are calculated per mL. The average of the quantity of a mL represented by a drop is also recorded. A data table is set up to represent the trail averages. First 2. 0 mL of unknown acid is measured into graduated cylinder and then poured into a beaker the volume is the recorded. By using a toothpick a drop of acid is placed onto low portion of pH paper, the pH level is recorded. One drop of the phenolphthalein indictor is added to the acid and the color is recorded. The beaker is set on a white sheet of paper before moving on. Next, a well in the 24-well plate is filled with NaOH solution and then sucked up into an empty pipet. The pipet is the held vertically slowly adding drop by drop the NaOH into the beaker of the unknown solution. Drops are added until a color change occurs, changing to a faint pink for at least 30 seconds. A plastic spoon is used to stir after the addition of each drop. The number of drops of NaOH is recorded and the equivalence point is now determined. A drop of the acid is now transferred by toothpick to the high range pH indicator strip. The pH level of the acid is recorded before titration. The contents of the beaker are poured down the drain and all equipment is thoroughly cleaned. The above procedure is repeated twice more, all data is recorded to 4 decimal places for each trail on the data table. The average of the 3 trails is calculated and data is recorded. At the top of the pH column the unknown’s acid’s starting pH level before titration is entered. Next, the pH level of the acid after the titration, at its equivalence point is entered at the bottom of the pH column. The appropriate pH levels for each 2 drop interval is then calculated, by subtracting the initial pH from the final pH and dividing the resulting difference by the number of rows minus 1. This number is then added to the previous pH value. A graph is then made, pH is plotted on the y axis and volume of NaOH added on the x axis. This represents the titration curve. The pH that corresponds with the equivalence point and half equivalence points are located and the pKa is determined for the unknown acid, pH=pKa. The relationship between Ka and pKa is that Ka is the equilibrium constant for the dissociation of a weak acid and pKa is the half-equivalence point where pH=pKa. In addition to the pH, Ka is an indication of an acids strength; pKa = log Ka. B. The potential sources for errors in this experiment are the inconsistent and miscounting of drops of NaOH in the titration. The pipet must be held upright dispensing the exact size drops to have an accurate measurement. C. If your experimental Ka is 5. 3 and the actual Ka of your unknown acid is 4. 7, what is your % error?

Epigenetic Control of Endocannabinoid Function

Epigenetic Control of Endocannabinoid Function Janis Szeremeta Epigenetic control of endocannabinoid function Prostate cancer is one of the most frequently diagnosed types of tumours in the male population worldwide. The endocannabinoid system, more specifically high expression of cannabinoid receptor 1 (CB1) in tumour tissue, has been associated with poor prognosis in prostate cancer and suggested as a prognostic marker. Epigenetic silencing has previously been shown to upregulate CB1 mRNA expression in colon cancer cell lines and to induce expression of normally silenced cannabinoid receptor 2 (CB2) mRNA in a neuroblastoma cell line. In the present study, potential effects of epigenetic modulation on the expression of 12 different components of the endocannabinoid system (receptors, synthetic and catabolic enzymes) were investigated in a prostate cancer and a neuroblastoma cell line. Additionally, two catabolic pathways were investigated in functional assays. In general, changes in mRNA expression levels produced by treatment with the epigenetic modulators, 5-aza-2-deoxycytidine and Tricho statin A were small, and, in the case of the catabolic enzyme fatty acid amide hydrolase in DU-145 prostate cancer cells were not accompanied by observable changes in hydrolysis rates. In SH-SY5Y neuroblastoma cells a low expression of monoacylglycerol lipase was found and this was also observed in functional assays. It is concluded that for the cell lines investigated, the epigenetic modulators tested do not modify the endocannabinoid system to any obvious degree, at least at the mRNA level. Since these experiments were conducted on a single cell line of a specific cell type only, introduction of alternative prostate cancer cell lines, such as PC-3 or LNCaP, might have different outcomes and should be considered for future experiments. Due to its involvement in a variety of physiological and pathophysiological conditions, such as obesity, pain, immunomodulation and cancer1, the endocannabinoid system has emerged as an important area of research. Endogenous lipid transmitters, the so-called endocannabinoids, act by binding and activating the G-protein coupled cannabinoid receptors 1 and 2 (CB1/ CB2). Endocannabinoid levels are tightly regulated by a network of synthesizing and catabolizing enzymes (Figure 1). Two lipid mediators, N-arachidonoylethanolamine (anandamide, AEA) and 2-arachidonoylglycerol (2-AG), remain the most thoroughly studied endocannabinoids to date. 2-AG is derived from hydrolysis of diacylglycerols (DAGs) containing arachidonic acid via diacylglycerol lipases ÃŽÂ ± and ÃŽÂ ² (DGLÃŽÂ ±/ÃŽÂ ²) and then hydrolysed to arachidonic acid mainly via monoacylglycerol lipase (MGL) but also by ÃŽÂ ±/ÃŽÂ ²-hydrolase domain containing 6 and 12 (ABHD6, ABHD12)2. AEA is derived from N-acylphos phatidylethanolamines (NAPEs) by hydrolysis via NAPE-phospholipase D (NAPE-PLD). It is inactivated by hydrolysis via fatty acid amide hydrolase (FAAH) and N-acylethanolamine acid amide hydrolase (NAAA) to arachidonic acid. Arachidonic acid is a substrate for many enzymes, including cyclooxygenase (COX) -1 and -2, 5- and 12-lipoxygenases (5/12-LOX) to produce prostaglandins, 5- and 12- hydroxyicosatetraenoic acid (5/12-HETE), respectively. Both 2-AG and AEA can also be hydrolysed to prostaglandin H2 derivatives via COX-23. Current modulators of the endocannabinoid system include a variety of selective pharmacological inhibitors for these enzymes which can be used to study their functional roles in the body (see Figure 1 for compounds used in this study). Figure 1: Simplified view of the endocannabinoid system. G-protein coupled receptors CB1 and CB2 are activated by lipid mediators, in this case 2-AG and anandamide (AEA) as well as by plant derived and synthetic compounds (not depicted). 2-AG and AEA are synthesized from diacylglycerol or N-acylphosphatidylethanolamine precursors and act locally. Both messengers are hydrolysed to arachidonic acid and/or prostaglandin H2 derivatives. Descriptions given in green were investigated towards changes in mRNA expression following epigenetic modulation treatment. Descriptions given in red show endocannabinoid metabolizing enzyme inhibitors. Abbreviations: Penta, Pentadecylamine (after Muccioli 20103). The endocannabinoid system is becoming a more and more important therapeutic target in cancer, and very interestingly, different types of cancer appear to react differently to changes in endocannabinoid balance, with oftentimes opposing effects ranging for example from pro- to antiapoptotic4. This shows why understanding how the endocannabinoid system is regulated in health and disease remains an important part of research. An important hallmark of cancer formation of cancer is the occurrence of epigenetic alterations5,6. Aberrant DNA methylation has been found in various types of cancer and effects vary between hyper- and hypomethylation states and in different types of cancer (see Kulis et al 20107). DNA methylation is usually associated with inhibition of gene expression. Cytosine nucleotides are methylated at the fifth carbon to form 5-methylcytosine, which can hinder transcription factor binding and therefore interfere with gene expression8. 5-Aza-2-deoxycytidine is a DNA demethylation compound that is able to replace and mimic cytosine in the DNA. In case of a cytosine replacement, DNA methyltransferases (DNMTs), that would normally catalyse methylation of cytosines, will now be bound covalently to 5-Aza-2-deoxycytidine, leading to degradation and depletion of DNMT protein levels and therefore a decrease of DNA methylation9. Note that this process is unspecific and generally decreases overall DNA methylation. Histone acetylation, a different type of epigenetic modification, is associated with activation of gene transcription. Occurring on lysine residues of histones, histone acetylation is associated with a charge neutralization of the positively charged histone molecules. This neutralization reaction is thought to decrease interaction between negatively charged DNA phosphate backbones and their positively charged histone counterparts, therefore increasing DNA availability10. Histone acetylation is regulated by an interplay of histone acetylases (HATs) and histone deacetylases (HDACs)11. Inhibition of HDACs may be used to constitutively activate histone acetylation mediated gene expression. Prostate cancer has become one of the most frequently diagnosed malignancies in men throughout Europe12. Current evidence suggests that high a CB1 receptor immunoreactivity is correlated to disease severity and outcome13. Several prostate cancer cell lines and human prostate cancer tissues have been shown to express CB1 receptors using various techniques, such as qPCR, immunofluorescence and western blotting13-16. There is evidence that CB1 expression is regulated epigenetically in colorectal cancer, where DNA hypermethylation lead to a loss of CB1 expression17. The same study found inhibition of epigenetic silencing (i.e. removal of DNA methylation) increased Cnr1 mRNA expression in seven out of eight colorectal cancer cell lines. A different study investigated the effects of two different epigenetic modulators, 5-Aza-2-deoxycytidine (Aza dC) and Trichostatin A (TSA), a histone deacetylase inhibitor, upon CB receptor expression in two different cell lines18. Inhibition of epigenetic silencing in Jurkat T cells increased Cnr1 mRNA expression in an additive manner but did not affect Cnr2 mRNA expression, whereas treatment of human SH-SY5Y neuroblastoma cells lead to induction of normally silenced Cnr2 mRNA expression, again in an additive manner, but no changes in Cnr1 mRNA. Whilst the above data implicate epigenetic regulation of CB receptors, it is not known whether it is seen in prostate cancer cells, and there is no data concerning the endocannabinoid synthetic and catabolic enzymes. In consequence, the present study investigated the effects of Aza dC and Trichostatin A treatment upon mRNA expression for 12 different endocannabinoid-related genes (see Figure 1). Differences that were found were investigated in hydrolysis experiments and changes in either AEA or 2-AG hydrolysis. In addition, since tumours are often located in hypoxic microenvironments19, cell lines were exposed to hypoxic conditions for increasing intervals up to 24 h and the same panel of endocannabinoid system components was investigated towards mRNA expression. Cells were either placed into anoxic incubation chambers or exposed to hypoxia mimetics such as Co(II)Cl220 or deferoxamine21. Drugs and Compounds Radiolabeled compounds ([3H]-2-OG (60 Ci/mmol)), [3H]-AEA (60 Ci/mmol)) were obtained from American Radiolabeled Chemicals Inc, St. Louis, MO, USA. URB597, JZL184, WWL70 were obtained from the Cayman Chemical Co. (Ann Arbor, MI, USA). Pentadecylamine, 5-Aza-2-deoxycytidine (Aza dC), Trichostatin A, Co(II)Cl2 were obtained from Sigma-Aldrich (St. Louis, MO, USA). Cell Culture Human DU-145 (prostate cancer, passage range 17 to 29) and SH-SY5Y (neuroblastoma, passage range 19 to 28) cells were expanded in Eagles Minimal Essential Medium (EMEM ATCC 30-2003) supplemented with penicillin, streptomycin (10,000 U/mL each, Gibco by Life Technologies) and 10% FBS (Gibco by Life Technologies) in 75 mL flasks at 37ËÅ ¡C with 5% atmospheric CO2. Cells were plated in 24 well plates with a total number of cells of 1.5 ÃÆ'- 105 for DU-145 and 2.5 ÃÆ'- 105 cells for SH-SY5Y per well overnight. Epigenetic Modulation using 5-Aza-2-deoxycytidine and Trichostatin A Following the overnight plating, DU-145 and SH-SY5Y cells were treated by replacing the old medium with a fresh layer of medium containing Aza dC (1  µM), Trichostatin A (25 nm), a combination of both, or vehicle (DMSO 0.1%) as control for 24 h. After 24 h hours, cells were lysed according to the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) instructions and mRNA was extracted. Exposure to Hypoxia/Hypoxia Mimetics Induction of hypoxia was achieved via two different methods. Cells were seeded into 24 well plates and either kept in a hypoxic environment or were exposed to the hypoxia mimetic Co(II)Cl2. A hypoxic atmosphere inside an airtight modular incubation chamber (Billups Rothenberg Inc, San Diego, CA, USA) was achieved by first flushing the medium with a hypoxic gas mix (1% O2, 99% CO2) at a rate of 3 L/min for 5 minutes. The old medium was replaced with a layer of flushed medium and plates were placed into the airtight chamber. The chamber was flushed with hypoxic gas at a rate of 20 L/min for 5 minutes (per manufacturers instructions22) and then incubated at 37ËÅ ¡C for either 2, 4, 6, 8 or 24 h. Co(II)Cl2 was used at a final concentration of 50 mM and cells were incubated for 2, 4, 6, 8 or 24 h. HIF1ÃŽÂ ± and HIF2ÃŽÂ ± mRNA levels were assessed for both procedures to evaluate induction of hypoxia. qPCR mRNA was extracted using the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit. mRNA (5  µg of total) was used for reverse transcription using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, Thermo Fisher Scientific). qPCR reaction mixtures were prepared using the KAPA SYBR FAST qPCR Master Mix (2X, KAPA Biosystems, Wilmington, MA, USA) to a final Volume of 20  µL. Reactions were run on the Illumina Eco Real Time PCR system (Illumina Inc, San Diego, CA, USA) with an initial denaturation time of 10 minutes at 95ËÅ ¡C, 45 cycles of 10 seconds at 95ËÅ ¡C and 30 seconds at 60ËÅ ¡C and melting curve cycle times of 15 seconds at 95ËÅ ¡C, 15 seconds at 55ËÅ ¡C and a final step of 95ËÅ ¡C for an additional 15 seconds. Primers (Table 1) were synthesized at Integrated DNA Technologies (Coralville, IA, USA). Amounts of transcripts were normalized to ribosomal protein L19 (RPL19) and relative quantification was perf ormed using the ˆâ€  Ã‹â€ Ã¢â‚¬  Ct method. Table 1: primers used for qPCR experiments Gene Product Forward primer (5 to 3) Reverse primer (5 to 3) Abhd6 ABHD6 GATGTCCGCATCCCTCATAAC CCAGCACCTGGTCTTGTTTC Abhd12 ABHD12 GGCAGAAAGCTCTATAGCATCG CCTGTAGCCAAGGTCTGAATG Cnr1 CB1 CACCTTCCGCACCATCACCAC GTCTCCCGCAGTCATCTTCTCTTG Cnr2 CB2 1st pair CATGGAGGAATGCTGGGTGAC GAGGAAGGCGATGAACAGGAG CB2 2nd pair AAACAACTGGGACTCCTC GTCTAGAAGGCTTTGGGTTG Ptgs2 COX-2 AGCAGGCAGATGAAATACCAG ACCAGAAGGGCAGGATACA Dagla DAGLÃŽÂ ± CCCAAATGGCGGATCATCG GGCTGAGAGGGCTATAGTTAGG Daglb DAGLÃŽÂ ² TCAGGTGCTACGCCTTCTC TCACACTGAGCCTGGGAATC Faah FAAH CACACGCTGGTTCCCTTCTT GGGTCCACGAAATCACCTTTGA Hif1a HIF1ÃŽÂ ± GCTGATTTGTGAACCCATTCC TTCATATCCAGGCTGTGTCG Epas1 HIF2ÃŽÂ ± CACAGAGTTCTTGGGAGCAG ACCCTTTGCAGACCTTGTC Alox5 5-LOX ATCCAGCTCAACCAAATCCC ACCAGATGTGTTCGCAGAAG Alox12 12-LOX GATCCGAGGAGAGAAGCAATAC GGAGGCTGAATCTGGATGAC Alox15 15-LOX CGAGGGTTTCCTGTCTCTTTAC GCACCCAAGAGTACCAGTC Mgll MAGL GGAAACAGGACCTGAAGACC ACTGTCCGTCTGCATTGAC Naaa NAAA ATGGAGCGTGGTTCCGAGTT AGGCTGAGGTTTGCTTGTCCT Napepld NAPE-PLD ACTGGTTATTGCCCTGCTTT AATCCTTACAGCTTCTTCTGGG Rpl19 RPL19 CACATCCACAAGCTGAAGGCA CTTGCGTGCTTCCTTGGTCT [3H]-AEA Hydrolysis in DU-145 Cells The assay of Bjà ¶rklund et al. (2014)23 was used. Cells (1.5 ÃÆ'- 105 per well) were plated and kept overnight to allow for cell adherence. Subsequently, cells were treated with Aza dC (1  µM) for 24 h or left untreated as control. Non-enzymatic hydrolysis was measured in non-cell containing wells. Wells were washed with KRH buffer (120 mM NaCl, 4.7 mM KCl, 2.2 mM CaCl2.2H2O, 10 mM HEPES, 0.12 mM KH2PO4, 0.12 mM MgSO4 containing 1% BSA (Sigma Aldrich) followed by KRH buffer alone. KRH buffer containing 0.1% fatty-acid free BSA (Sigma Aldrich) was added to the wells and plates were kept in a water bath at 37ËÅ ¡C. Inhibitors (URB597 1  µM, Pentadecylamine 1  µM, URB597 and Pentadecylamine 1 µM each) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C. [3H]-AEA (diluted with non-radioactive AEA to give a final assay concentration of 0.5  µM) was added and plates were incubated for a further 15 minutes resulting in a total reaction vol ume of 400  µL. The hydrolysis reaction was stopped by adding 600  µL activated charcoal in 0.5 M hydrochloric acid and plates were kept on ice. Charcoal and aqueous phase were separated by centrifugation (2,500 rpm, 10 min.), 200  µL of the aqueous phase were recovered and mixed with 4 mL scintillation liquid (ULTIMA GOLD, PerkinElmer) for liquid scintillation radioactivity determination with quench correction. The [3H]-AEA used is labelled in the ethanolamine part of the molecule, and the [3H]-ethanolamine produced by the hydrolysis of [3H]-AEA does not adsorb to the charcoal, whereas the [3H]-AEA does adsorb24. [3H]-2-OG Hydrolysis in SH-SY5Y Cells Cells (2.5 ÃÆ'- 105 per well) were plated and incubated overnight to allow for cell adherence. Non-enzymatic hydrolysis was measured in non-cell containing wells. The assay used was the same as for [3H]-AEA hydrolysis, but using 0.5  µM [3H]-2-OG (labelled in the glycerol part of the molecule). Inhibitors (URB597 1  µM, JZL184 1  µM, WWL70 10  µM, a combination of URB597, JZL184 and WWL70 and a combination of JZL184 and WWL70 at the aforementioned concentrations) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C followed by addition of substrate and incubation for a further 15 min. See above for determination of radioactivity in aqueous phase. Cytotoxicity Assessment/Assay To determine the cytotoxicity of the various treatments throughout this project the LDH cytotoxicity detection kit from Roche (Cat. No. 11 644 793 001) was used per manufacturers protocol. Statistical Analyses Statistical analyses were undertaken by my Supervisor using the function ezANOVA in the package ez for the R statistical programme (R Core Team, URL http://www.R-project.org/). The details and the command lines used are given in Table 2. Epigenetic regulation of endocannabinoid function DU-145 and SH-SY5Y cells were treated for 24h with either Aza dC, TSA or a combination of both compounds, after which mRNA was extracted and analused for expression of marker of the endocannabinoid system. Table 2 shows the summarized data of the statistical analysis obtained in the gene expression studies. Main effects are given in the left half of the table. Significant differences were found for a various number of genes and are given in bold type. Main effects cell describes the comparison of gene expression between DU-145 and SH-SY5Y cells. The columns with Aza dC and TSA describe the effect of the epigenetic modulators on mRNA expression of the gene of interest and only a few of them were statistically significant (i.e. DGLÃŽÂ ² and FAAH for Aza dC and 12-LOX for TSA). Interpretation of the main effects is difficult when there are significant interactions. Values in bold type indicate an interaction between components) for four of the twelve genes of interest. In these cases, individual two-way ANOVAs helped to determine actual differences for each cell line per se. Results of these ANOVAs can be found below their corresponding figures (see Figure 2, Figure 3 and Figure 4) with a P Table 2: Three-way ANOVA summary for the PCR data. Main effects Interactions Cell: Cell: Cell: Aza dC: Aza dC: Protein Cell Aza dC TSA Aza dC TSA TSA TSA CB1 0.0003 0.31 0.060 0.38 0.89 0.14 0.30 NAPE-PLD 0.34 0.40 0.28 0.0093 0.29 0.29 0.54 DGLÃŽÂ ± 0.87 0.88 0.0049 0.49 0.16 0.61 DGLÃŽÂ ² 0.43 0.0004 0.027 0.020 0.031 0.88 0.96 FAAH 0.041 0.0061 0.55 0.17 0.85 NAAA 0.012 0.53 0.44 0.79 0.15 0.40 MGL 0.21 0.019 0.014 0.85 0.25 0.59 ABHD6 0.0004 0.019 0.15 0.0001 0.70 0.43 0.67 ABHD12 0.0078 0.014 0.65 0.091 0.14 0.61 0.11 COX2 0.032 0.62 0.21 0.70 0.83 0.74 5-LOX 0.99 0.45 0.21 0.91 0.98 0.13 0.53 12-LOX 0.0039 0.18 0.0001 0.41 0.55 0.93 0.69 Data shows the ANOVA p values for each protein, calculated for the data expressed as ˆâ€  Ct using the function ezANOVA in the package ez for the R statistical programme. The command line used was Model25). P values in bold type are those where significance remained after implementation of a 5% false discovery rate (Benjamini Hochberg, 199526). When the interaction cell type x Aza dC was significant, two-way ANOVA matching for Aza dC and TSA have been calculated for each cell type separately, and these are shown in the figures. Note that for DGLÃŽÂ ² and MGL the variances were different for the DU145 and SH-SY5Y cells and this will affect accuracy of the P values. In these cases, the cells have been analysed separately and the ANOVA values given in the figures. Cannabinoid receptors 1 and 2 Figure 2: Panel A, mRNA levels for CB1 receptors in DU145 and SH-SY5Y cells treated with Aza dC and/or TSA. The graphs show the individual ˆâ€  Ct values (bars show the means), N=6 per group (each assayed in triplicate), with the corresponding % of controls on the right column. For statistical treatment, see Table 2. Panel B, melting curves for the primers used for CB1 and CB2 receptors. The melting curves are for the DU145 cells. Gene expression analysis data of CB1 mRNA is given in Figure 2A. Expression rates were significantly different between the two cell lines, but neither Aza dC nor Trichostatin A had an effect. No interactions between the compounds and the cell types were found (Table 2) Unfortunately, two different primer pairs, designed to amplify Cnr2 mRNA did not give detectable and reproducible mRNA expression of CB2, so no expression data could be obtained for CB2 (Figure 1B). The first primer pair was taken from a previous publication by Bà ¶rner et al whereas the second pair was designed on site. Figure 1B shows the different melting curves obtained during the qPCR assays for DU-145, with similar results for SH-SY5Y cells. Endocannabinoid synthetic enzymes Figure 3: mRNA levels of the endocannabinoid synthetic enzymes NAPE-PLD (A), DGLÃŽÂ ± (B) and DGLÃŽÂ ² (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panels A and B) or when the variance was different for the two cell types (Panel C). Effects of epigenetic modulation on the expression of endocannabinoid synthetic enzymes are shown in Figure 2. No main effects of either Aza dC or TSA were detected for NAPE-PLD or DGLÃŽÂ ±, there was an interaction between the different cell types and the Aza dC treatment, however (see Table 2). For these samples a two-way ANOVA was calculated and values are given below each figure. Indiviual treatments did not have any significant effect on the expression of both NAPE-PLD and DGLÃŽÂ ± (Figure 2A and B), an additive effect of Aza dC and TSA could be observed for the expression of DGLÃŽÂ ± in DU-145 cells, where expression decreased to a small degree. For DGLÃŽÂ ², since the variance was different for both cell types, a two-way ANOVA was calculated for each. No significant effects were observed for DGLÃŽÂ ² expression in SH-SY5Y cells. However, both Aza dC and TSA had significant main effects in the DU-145 cells, although the sizes of the changes produced by the compou nds were very small (Figure 2C). AEA catabolic enzymes Figure 4: mRNA levels of the endocannabinoid catabolic enzymes FAAH (A) and NAAA (B). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel A). As seen in Table 2, Aza dC had both a significant main effect, but also displayed interaction between the cell types and the compound for FAAH. The two-way ANOVA for FAAH resulted in significant differences only for the Aza dC treatment in DU-145, but not in SH-SY5Y. Once again, the effects were very small in size. Trichsotatin A did not have an effect in either cell line, neither individually nor in combination (Figure 3A). No significant differences were found for NAAA (Figure 3B). 2-AG catabolic enzymes Figure 5: mRNA levels of the endocannabinoid catabolic enzymes MGL (A), ABHD6 (B) and ABHD12 (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel B) or when the variance was different for the two cell types (Panel A). Gene expression analysis of the three key enzym