Friday, September 6, 2019

Determination of Ka for a weak Acdi Essay Example for Free

Determination of Ka for a weak Acdi Essay In the experiment preformed the objective is to titrate a weak acid with a strong base. In a titration of a weak acid with a strong base the titrant is the strong base and the analyte is a weak acid. The reaction that will occur is the direct transfer of protons from the weak acid to the hydroxide ion. The data gathered will be represented on the titration curve, a graph of the volume of titrant being the strong base plotted against the pH . The pH is an indicator of an acids strength. The titration curve can be used to determine the pKa. By reading the graph the equivalence point can be found; which is the point where equal parts acid and base have reacted by knowing this the half-equivalence can be found pH=pKa. Procedure In the experiment pH paper will be used instead of a pH meter. The pH will be determined at the beginning and the end of the titration and the data table will be used to calculate the intermediate values. A burette is a more accurate piece of glassware used to deliver the titrate; in the lab being performed disposable pipet will be used making it very important to consistently dispense the same size drops. Before the titration the volume of a drop must be determined. A pipet is completely fill with distilled water. The average number of drops in a mL and the average quantity of a mL represented by on drop is calculated and recorded. Water is added drop by drop to a graduated cylinder from a pipet at the first, second and third mL lines the water drops are recorded. The average number of drops are calculated per mL. The average of the quantity of a mL represented by a drop is also recorded. A data table is set up to represent the trail averages. First 2. 0 mL of unknown acid is measured into graduated cylinder and then poured into a beaker the volume is the recorded. By using a toothpick a drop of acid is placed onto low portion of pH paper, the pH level is recorded. One drop of the phenolphthalein indictor is added to the acid and the color is recorded. The beaker is set on a white sheet of paper before moving on. Next, a well in the 24-well plate is filled with NaOH solution and then sucked up into an empty pipet. The pipet is the held vertically slowly adding drop by drop the NaOH into the beaker of the unknown solution. Drops are added until a color change occurs, changing to a faint pink for at least 30 seconds. A plastic spoon is used to stir after the addition of each drop. The number of drops of NaOH is recorded and the equivalence point is now determined. A drop of the acid is now transferred by toothpick to the high range pH indicator strip. The pH level of the acid is recorded before titration. The contents of the beaker are poured down the drain and all equipment is thoroughly cleaned. The above procedure is repeated twice more, all data is recorded to 4 decimal places for each trail on the data table. The average of the 3 trails is calculated and data is recorded. At the top of the pH column the unknown’s acid’s starting pH level before titration is entered. Next, the pH level of the acid after the titration, at its equivalence point is entered at the bottom of the pH column. The appropriate pH levels for each 2 drop interval is then calculated, by subtracting the initial pH from the final pH and dividing the resulting difference by the number of rows minus 1. This number is then added to the previous pH value. A graph is then made, pH is plotted on the y axis and volume of NaOH added on the x axis. This represents the titration curve. The pH that corresponds with the equivalence point and half equivalence points are located and the pKa is determined for the unknown acid, pH=pKa. The relationship between Ka and pKa is that Ka is the equilibrium constant for the dissociation of a weak acid and pKa is the half-equivalence point where pH=pKa. In addition to the pH, Ka is an indication of an acids strength; pKa = log Ka. B. The potential sources for errors in this experiment are the inconsistent and miscounting of drops of NaOH in the titration. The pipet must be held upright dispensing the exact size drops to have an accurate measurement. C. If your experimental Ka is 5. 3 and the actual Ka of your unknown acid is 4. 7, what is your % error?

Thursday, September 5, 2019

Epigenetic Control of Endocannabinoid Function

Epigenetic Control of Endocannabinoid Function Janis Szeremeta Epigenetic control of endocannabinoid function Prostate cancer is one of the most frequently diagnosed types of tumours in the male population worldwide. The endocannabinoid system, more specifically high expression of cannabinoid receptor 1 (CB1) in tumour tissue, has been associated with poor prognosis in prostate cancer and suggested as a prognostic marker. Epigenetic silencing has previously been shown to upregulate CB1 mRNA expression in colon cancer cell lines and to induce expression of normally silenced cannabinoid receptor 2 (CB2) mRNA in a neuroblastoma cell line. In the present study, potential effects of epigenetic modulation on the expression of 12 different components of the endocannabinoid system (receptors, synthetic and catabolic enzymes) were investigated in a prostate cancer and a neuroblastoma cell line. Additionally, two catabolic pathways were investigated in functional assays. In general, changes in mRNA expression levels produced by treatment with the epigenetic modulators, 5-aza-2-deoxycytidine and Tricho statin A were small, and, in the case of the catabolic enzyme fatty acid amide hydrolase in DU-145 prostate cancer cells were not accompanied by observable changes in hydrolysis rates. In SH-SY5Y neuroblastoma cells a low expression of monoacylglycerol lipase was found and this was also observed in functional assays. It is concluded that for the cell lines investigated, the epigenetic modulators tested do not modify the endocannabinoid system to any obvious degree, at least at the mRNA level. Since these experiments were conducted on a single cell line of a specific cell type only, introduction of alternative prostate cancer cell lines, such as PC-3 or LNCaP, might have different outcomes and should be considered for future experiments. Due to its involvement in a variety of physiological and pathophysiological conditions, such as obesity, pain, immunomodulation and cancer1, the endocannabinoid system has emerged as an important area of research. Endogenous lipid transmitters, the so-called endocannabinoids, act by binding and activating the G-protein coupled cannabinoid receptors 1 and 2 (CB1/ CB2). Endocannabinoid levels are tightly regulated by a network of synthesizing and catabolizing enzymes (Figure 1). Two lipid mediators, N-arachidonoylethanolamine (anandamide, AEA) and 2-arachidonoylglycerol (2-AG), remain the most thoroughly studied endocannabinoids to date. 2-AG is derived from hydrolysis of diacylglycerols (DAGs) containing arachidonic acid via diacylglycerol lipases ÃŽÂ ± and ÃŽÂ ² (DGLÃŽÂ ±/ÃŽÂ ²) and then hydrolysed to arachidonic acid mainly via monoacylglycerol lipase (MGL) but also by ÃŽÂ ±/ÃŽÂ ²-hydrolase domain containing 6 and 12 (ABHD6, ABHD12)2. AEA is derived from N-acylphos phatidylethanolamines (NAPEs) by hydrolysis via NAPE-phospholipase D (NAPE-PLD). It is inactivated by hydrolysis via fatty acid amide hydrolase (FAAH) and N-acylethanolamine acid amide hydrolase (NAAA) to arachidonic acid. Arachidonic acid is a substrate for many enzymes, including cyclooxygenase (COX) -1 and -2, 5- and 12-lipoxygenases (5/12-LOX) to produce prostaglandins, 5- and 12- hydroxyicosatetraenoic acid (5/12-HETE), respectively. Both 2-AG and AEA can also be hydrolysed to prostaglandin H2 derivatives via COX-23. Current modulators of the endocannabinoid system include a variety of selective pharmacological inhibitors for these enzymes which can be used to study their functional roles in the body (see Figure 1 for compounds used in this study). Figure 1: Simplified view of the endocannabinoid system. G-protein coupled receptors CB1 and CB2 are activated by lipid mediators, in this case 2-AG and anandamide (AEA) as well as by plant derived and synthetic compounds (not depicted). 2-AG and AEA are synthesized from diacylglycerol or N-acylphosphatidylethanolamine precursors and act locally. Both messengers are hydrolysed to arachidonic acid and/or prostaglandin H2 derivatives. Descriptions given in green were investigated towards changes in mRNA expression following epigenetic modulation treatment. Descriptions given in red show endocannabinoid metabolizing enzyme inhibitors. Abbreviations: Penta, Pentadecylamine (after Muccioli 20103). The endocannabinoid system is becoming a more and more important therapeutic target in cancer, and very interestingly, different types of cancer appear to react differently to changes in endocannabinoid balance, with oftentimes opposing effects ranging for example from pro- to antiapoptotic4. This shows why understanding how the endocannabinoid system is regulated in health and disease remains an important part of research. An important hallmark of cancer formation of cancer is the occurrence of epigenetic alterations5,6. Aberrant DNA methylation has been found in various types of cancer and effects vary between hyper- and hypomethylation states and in different types of cancer (see Kulis et al 20107). DNA methylation is usually associated with inhibition of gene expression. Cytosine nucleotides are methylated at the fifth carbon to form 5-methylcytosine, which can hinder transcription factor binding and therefore interfere with gene expression8. 5-Aza-2-deoxycytidine is a DNA demethylation compound that is able to replace and mimic cytosine in the DNA. In case of a cytosine replacement, DNA methyltransferases (DNMTs), that would normally catalyse methylation of cytosines, will now be bound covalently to 5-Aza-2-deoxycytidine, leading to degradation and depletion of DNMT protein levels and therefore a decrease of DNA methylation9. Note that this process is unspecific and generally decreases overall DNA methylation. Histone acetylation, a different type of epigenetic modification, is associated with activation of gene transcription. Occurring on lysine residues of histones, histone acetylation is associated with a charge neutralization of the positively charged histone molecules. This neutralization reaction is thought to decrease interaction between negatively charged DNA phosphate backbones and their positively charged histone counterparts, therefore increasing DNA availability10. Histone acetylation is regulated by an interplay of histone acetylases (HATs) and histone deacetylases (HDACs)11. Inhibition of HDACs may be used to constitutively activate histone acetylation mediated gene expression. Prostate cancer has become one of the most frequently diagnosed malignancies in men throughout Europe12. Current evidence suggests that high a CB1 receptor immunoreactivity is correlated to disease severity and outcome13. Several prostate cancer cell lines and human prostate cancer tissues have been shown to express CB1 receptors using various techniques, such as qPCR, immunofluorescence and western blotting13-16. There is evidence that CB1 expression is regulated epigenetically in colorectal cancer, where DNA hypermethylation lead to a loss of CB1 expression17. The same study found inhibition of epigenetic silencing (i.e. removal of DNA methylation) increased Cnr1 mRNA expression in seven out of eight colorectal cancer cell lines. A different study investigated the effects of two different epigenetic modulators, 5-Aza-2-deoxycytidine (Aza dC) and Trichostatin A (TSA), a histone deacetylase inhibitor, upon CB receptor expression in two different cell lines18. Inhibition of epigenetic silencing in Jurkat T cells increased Cnr1 mRNA expression in an additive manner but did not affect Cnr2 mRNA expression, whereas treatment of human SH-SY5Y neuroblastoma cells lead to induction of normally silenced Cnr2 mRNA expression, again in an additive manner, but no changes in Cnr1 mRNA. Whilst the above data implicate epigenetic regulation of CB receptors, it is not known whether it is seen in prostate cancer cells, and there is no data concerning the endocannabinoid synthetic and catabolic enzymes. In consequence, the present study investigated the effects of Aza dC and Trichostatin A treatment upon mRNA expression for 12 different endocannabinoid-related genes (see Figure 1). Differences that were found were investigated in hydrolysis experiments and changes in either AEA or 2-AG hydrolysis. In addition, since tumours are often located in hypoxic microenvironments19, cell lines were exposed to hypoxic conditions for increasing intervals up to 24 h and the same panel of endocannabinoid system components was investigated towards mRNA expression. Cells were either placed into anoxic incubation chambers or exposed to hypoxia mimetics such as Co(II)Cl220 or deferoxamine21. Drugs and Compounds Radiolabeled compounds ([3H]-2-OG (60 Ci/mmol)), [3H]-AEA (60 Ci/mmol)) were obtained from American Radiolabeled Chemicals Inc, St. Louis, MO, USA. URB597, JZL184, WWL70 were obtained from the Cayman Chemical Co. (Ann Arbor, MI, USA). Pentadecylamine, 5-Aza-2-deoxycytidine (Aza dC), Trichostatin A, Co(II)Cl2 were obtained from Sigma-Aldrich (St. Louis, MO, USA). Cell Culture Human DU-145 (prostate cancer, passage range 17 to 29) and SH-SY5Y (neuroblastoma, passage range 19 to 28) cells were expanded in Eagles Minimal Essential Medium (EMEM ATCC 30-2003) supplemented with penicillin, streptomycin (10,000 U/mL each, Gibco by Life Technologies) and 10% FBS (Gibco by Life Technologies) in 75 mL flasks at 37ËÅ ¡C with 5% atmospheric CO2. Cells were plated in 24 well plates with a total number of cells of 1.5 ÃÆ'- 105 for DU-145 and 2.5 ÃÆ'- 105 cells for SH-SY5Y per well overnight. Epigenetic Modulation using 5-Aza-2-deoxycytidine and Trichostatin A Following the overnight plating, DU-145 and SH-SY5Y cells were treated by replacing the old medium with a fresh layer of medium containing Aza dC (1  µM), Trichostatin A (25 nm), a combination of both, or vehicle (DMSO 0.1%) as control for 24 h. After 24 h hours, cells were lysed according to the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) instructions and mRNA was extracted. Exposure to Hypoxia/Hypoxia Mimetics Induction of hypoxia was achieved via two different methods. Cells were seeded into 24 well plates and either kept in a hypoxic environment or were exposed to the hypoxia mimetic Co(II)Cl2. A hypoxic atmosphere inside an airtight modular incubation chamber (Billups Rothenberg Inc, San Diego, CA, USA) was achieved by first flushing the medium with a hypoxic gas mix (1% O2, 99% CO2) at a rate of 3 L/min for 5 minutes. The old medium was replaced with a layer of flushed medium and plates were placed into the airtight chamber. The chamber was flushed with hypoxic gas at a rate of 20 L/min for 5 minutes (per manufacturers instructions22) and then incubated at 37ËÅ ¡C for either 2, 4, 6, 8 or 24 h. Co(II)Cl2 was used at a final concentration of 50 mM and cells were incubated for 2, 4, 6, 8 or 24 h. HIF1ÃŽÂ ± and HIF2ÃŽÂ ± mRNA levels were assessed for both procedures to evaluate induction of hypoxia. qPCR mRNA was extracted using the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit. mRNA (5  µg of total) was used for reverse transcription using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, Thermo Fisher Scientific). qPCR reaction mixtures were prepared using the KAPA SYBR FAST qPCR Master Mix (2X, KAPA Biosystems, Wilmington, MA, USA) to a final Volume of 20  µL. Reactions were run on the Illumina Eco Real Time PCR system (Illumina Inc, San Diego, CA, USA) with an initial denaturation time of 10 minutes at 95ËÅ ¡C, 45 cycles of 10 seconds at 95ËÅ ¡C and 30 seconds at 60ËÅ ¡C and melting curve cycle times of 15 seconds at 95ËÅ ¡C, 15 seconds at 55ËÅ ¡C and a final step of 95ËÅ ¡C for an additional 15 seconds. Primers (Table 1) were synthesized at Integrated DNA Technologies (Coralville, IA, USA). Amounts of transcripts were normalized to ribosomal protein L19 (RPL19) and relative quantification was perf ormed using the ˆâ€  Ã‹â€ Ã¢â‚¬  Ct method. Table 1: primers used for qPCR experiments Gene Product Forward primer (5 to 3) Reverse primer (5 to 3) Abhd6 ABHD6 GATGTCCGCATCCCTCATAAC CCAGCACCTGGTCTTGTTTC Abhd12 ABHD12 GGCAGAAAGCTCTATAGCATCG CCTGTAGCCAAGGTCTGAATG Cnr1 CB1 CACCTTCCGCACCATCACCAC GTCTCCCGCAGTCATCTTCTCTTG Cnr2 CB2 1st pair CATGGAGGAATGCTGGGTGAC GAGGAAGGCGATGAACAGGAG CB2 2nd pair AAACAACTGGGACTCCTC GTCTAGAAGGCTTTGGGTTG Ptgs2 COX-2 AGCAGGCAGATGAAATACCAG ACCAGAAGGGCAGGATACA Dagla DAGLÃŽÂ ± CCCAAATGGCGGATCATCG GGCTGAGAGGGCTATAGTTAGG Daglb DAGLÃŽÂ ² TCAGGTGCTACGCCTTCTC TCACACTGAGCCTGGGAATC Faah FAAH CACACGCTGGTTCCCTTCTT GGGTCCACGAAATCACCTTTGA Hif1a HIF1ÃŽÂ ± GCTGATTTGTGAACCCATTCC TTCATATCCAGGCTGTGTCG Epas1 HIF2ÃŽÂ ± CACAGAGTTCTTGGGAGCAG ACCCTTTGCAGACCTTGTC Alox5 5-LOX ATCCAGCTCAACCAAATCCC ACCAGATGTGTTCGCAGAAG Alox12 12-LOX GATCCGAGGAGAGAAGCAATAC GGAGGCTGAATCTGGATGAC Alox15 15-LOX CGAGGGTTTCCTGTCTCTTTAC GCACCCAAGAGTACCAGTC Mgll MAGL GGAAACAGGACCTGAAGACC ACTGTCCGTCTGCATTGAC Naaa NAAA ATGGAGCGTGGTTCCGAGTT AGGCTGAGGTTTGCTTGTCCT Napepld NAPE-PLD ACTGGTTATTGCCCTGCTTT AATCCTTACAGCTTCTTCTGGG Rpl19 RPL19 CACATCCACAAGCTGAAGGCA CTTGCGTGCTTCCTTGGTCT [3H]-AEA Hydrolysis in DU-145 Cells The assay of Bjà ¶rklund et al. (2014)23 was used. Cells (1.5 ÃÆ'- 105 per well) were plated and kept overnight to allow for cell adherence. Subsequently, cells were treated with Aza dC (1  µM) for 24 h or left untreated as control. Non-enzymatic hydrolysis was measured in non-cell containing wells. Wells were washed with KRH buffer (120 mM NaCl, 4.7 mM KCl, 2.2 mM CaCl2.2H2O, 10 mM HEPES, 0.12 mM KH2PO4, 0.12 mM MgSO4 containing 1% BSA (Sigma Aldrich) followed by KRH buffer alone. KRH buffer containing 0.1% fatty-acid free BSA (Sigma Aldrich) was added to the wells and plates were kept in a water bath at 37ËÅ ¡C. Inhibitors (URB597 1  µM, Pentadecylamine 1  µM, URB597 and Pentadecylamine 1 µM each) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C. [3H]-AEA (diluted with non-radioactive AEA to give a final assay concentration of 0.5  µM) was added and plates were incubated for a further 15 minutes resulting in a total reaction vol ume of 400  µL. The hydrolysis reaction was stopped by adding 600  µL activated charcoal in 0.5 M hydrochloric acid and plates were kept on ice. Charcoal and aqueous phase were separated by centrifugation (2,500 rpm, 10 min.), 200  µL of the aqueous phase were recovered and mixed with 4 mL scintillation liquid (ULTIMA GOLD, PerkinElmer) for liquid scintillation radioactivity determination with quench correction. The [3H]-AEA used is labelled in the ethanolamine part of the molecule, and the [3H]-ethanolamine produced by the hydrolysis of [3H]-AEA does not adsorb to the charcoal, whereas the [3H]-AEA does adsorb24. [3H]-2-OG Hydrolysis in SH-SY5Y Cells Cells (2.5 ÃÆ'- 105 per well) were plated and incubated overnight to allow for cell adherence. Non-enzymatic hydrolysis was measured in non-cell containing wells. The assay used was the same as for [3H]-AEA hydrolysis, but using 0.5  µM [3H]-2-OG (labelled in the glycerol part of the molecule). Inhibitors (URB597 1  µM, JZL184 1  µM, WWL70 10  µM, a combination of URB597, JZL184 and WWL70 and a combination of JZL184 and WWL70 at the aforementioned concentrations) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C followed by addition of substrate and incubation for a further 15 min. See above for determination of radioactivity in aqueous phase. Cytotoxicity Assessment/Assay To determine the cytotoxicity of the various treatments throughout this project the LDH cytotoxicity detection kit from Roche (Cat. No. 11 644 793 001) was used per manufacturers protocol. Statistical Analyses Statistical analyses were undertaken by my Supervisor using the function ezANOVA in the package ez for the R statistical programme (R Core Team, URL http://www.R-project.org/). The details and the command lines used are given in Table 2. Epigenetic regulation of endocannabinoid function DU-145 and SH-SY5Y cells were treated for 24h with either Aza dC, TSA or a combination of both compounds, after which mRNA was extracted and analused for expression of marker of the endocannabinoid system. Table 2 shows the summarized data of the statistical analysis obtained in the gene expression studies. Main effects are given in the left half of the table. Significant differences were found for a various number of genes and are given in bold type. Main effects cell describes the comparison of gene expression between DU-145 and SH-SY5Y cells. The columns with Aza dC and TSA describe the effect of the epigenetic modulators on mRNA expression of the gene of interest and only a few of them were statistically significant (i.e. DGLÃŽÂ ² and FAAH for Aza dC and 12-LOX for TSA). Interpretation of the main effects is difficult when there are significant interactions. Values in bold type indicate an interaction between components) for four of the twelve genes of interest. In these cases, individual two-way ANOVAs helped to determine actual differences for each cell line per se. Results of these ANOVAs can be found below their corresponding figures (see Figure 2, Figure 3 and Figure 4) with a P Table 2: Three-way ANOVA summary for the PCR data. Main effects Interactions Cell: Cell: Cell: Aza dC: Aza dC: Protein Cell Aza dC TSA Aza dC TSA TSA TSA CB1 0.0003 0.31 0.060 0.38 0.89 0.14 0.30 NAPE-PLD 0.34 0.40 0.28 0.0093 0.29 0.29 0.54 DGLÃŽÂ ± 0.87 0.88 0.0049 0.49 0.16 0.61 DGLÃŽÂ ² 0.43 0.0004 0.027 0.020 0.031 0.88 0.96 FAAH 0.041 0.0061 0.55 0.17 0.85 NAAA 0.012 0.53 0.44 0.79 0.15 0.40 MGL 0.21 0.019 0.014 0.85 0.25 0.59 ABHD6 0.0004 0.019 0.15 0.0001 0.70 0.43 0.67 ABHD12 0.0078 0.014 0.65 0.091 0.14 0.61 0.11 COX2 0.032 0.62 0.21 0.70 0.83 0.74 5-LOX 0.99 0.45 0.21 0.91 0.98 0.13 0.53 12-LOX 0.0039 0.18 0.0001 0.41 0.55 0.93 0.69 Data shows the ANOVA p values for each protein, calculated for the data expressed as ˆâ€  Ct using the function ezANOVA in the package ez for the R statistical programme. The command line used was Model25). P values in bold type are those where significance remained after implementation of a 5% false discovery rate (Benjamini Hochberg, 199526). When the interaction cell type x Aza dC was significant, two-way ANOVA matching for Aza dC and TSA have been calculated for each cell type separately, and these are shown in the figures. Note that for DGLÃŽÂ ² and MGL the variances were different for the DU145 and SH-SY5Y cells and this will affect accuracy of the P values. In these cases, the cells have been analysed separately and the ANOVA values given in the figures. Cannabinoid receptors 1 and 2 Figure 2: Panel A, mRNA levels for CB1 receptors in DU145 and SH-SY5Y cells treated with Aza dC and/or TSA. The graphs show the individual ˆâ€  Ct values (bars show the means), N=6 per group (each assayed in triplicate), with the corresponding % of controls on the right column. For statistical treatment, see Table 2. Panel B, melting curves for the primers used for CB1 and CB2 receptors. The melting curves are for the DU145 cells. Gene expression analysis data of CB1 mRNA is given in Figure 2A. Expression rates were significantly different between the two cell lines, but neither Aza dC nor Trichostatin A had an effect. No interactions between the compounds and the cell types were found (Table 2) Unfortunately, two different primer pairs, designed to amplify Cnr2 mRNA did not give detectable and reproducible mRNA expression of CB2, so no expression data could be obtained for CB2 (Figure 1B). The first primer pair was taken from a previous publication by Bà ¶rner et al whereas the second pair was designed on site. Figure 1B shows the different melting curves obtained during the qPCR assays for DU-145, with similar results for SH-SY5Y cells. Endocannabinoid synthetic enzymes Figure 3: mRNA levels of the endocannabinoid synthetic enzymes NAPE-PLD (A), DGLÃŽÂ ± (B) and DGLÃŽÂ ² (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panels A and B) or when the variance was different for the two cell types (Panel C). Effects of epigenetic modulation on the expression of endocannabinoid synthetic enzymes are shown in Figure 2. No main effects of either Aza dC or TSA were detected for NAPE-PLD or DGLÃŽÂ ±, there was an interaction between the different cell types and the Aza dC treatment, however (see Table 2). For these samples a two-way ANOVA was calculated and values are given below each figure. Indiviual treatments did not have any significant effect on the expression of both NAPE-PLD and DGLÃŽÂ ± (Figure 2A and B), an additive effect of Aza dC and TSA could be observed for the expression of DGLÃŽÂ ± in DU-145 cells, where expression decreased to a small degree. For DGLÃŽÂ ², since the variance was different for both cell types, a two-way ANOVA was calculated for each. No significant effects were observed for DGLÃŽÂ ² expression in SH-SY5Y cells. However, both Aza dC and TSA had significant main effects in the DU-145 cells, although the sizes of the changes produced by the compou nds were very small (Figure 2C). AEA catabolic enzymes Figure 4: mRNA levels of the endocannabinoid catabolic enzymes FAAH (A) and NAAA (B). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel A). As seen in Table 2, Aza dC had both a significant main effect, but also displayed interaction between the cell types and the compound for FAAH. The two-way ANOVA for FAAH resulted in significant differences only for the Aza dC treatment in DU-145, but not in SH-SY5Y. Once again, the effects were very small in size. Trichsotatin A did not have an effect in either cell line, neither individually nor in combination (Figure 3A). No significant differences were found for NAAA (Figure 3B). 2-AG catabolic enzymes Figure 5: mRNA levels of the endocannabinoid catabolic enzymes MGL (A), ABHD6 (B) and ABHD12 (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel B) or when the variance was different for the two cell types (Panel A). Gene expression analysis of the three key enzym

Wednesday, September 4, 2019

A Brief History of Unix :: Computer Science

A Brief History of Unix This document is designed to give people with no previous UNIX experience some sense of what UNIX is. This document will cover the history of UNIX and an introduction to UNIX. HISTORY OF UNIX AND CAUSES FOR ITS POPULARITY Most discussions of UNIX begin with the history of UNIX without explaining why the history of UNIX is important to understanding UNIX. The remainder of this document will describe some strengths and weaknesses of UNIX and attempt to explain why UNIX is becoming popular. All of UNIX's strengths and weaknesses can be directly related to the history of its development, hence a discussion of history is very useful. UNIX was originally developed at Bell Laboratories as a private research project by a small group of people starting in 1969. This group had experience with a number of different operating systems research efforts in the 1970's. The goals of the group were to design an operating system to satisfy the following objectives: Simple and elegant Written in a high level language rather than assembly language Allow re-use of code Typical vendor operating systems of the time were extremely large and all written in assembly language. UNIX had a relatively small amount of code written in assembly language (this is called the kernel) and the remaining code for the operating system was written in a high level language called C. The group worked primarily in the high level language in developing the operating system. As this development continued, small changes were necessary in the kernel and the language to allow the operating system to be completed. Through this evolution the kernel and associated software were extended until a complete operating system was written on top of the kernel in the language C. UNIX APPLICATION PROGRAMMING INTERFACE Many proprietary operating systems have a simplified view of application behavior. The typical application reads some data from disk, tape or a terminal and does some processing. Output is produced onto disk, tape, tape, terminal, or printer. The operating systems generally provide easy to use well-implemented facilities to support these types of facilities. As applications become more sophisticated they need new features such as network access, multi-tasking, and interprocess communications. In traditional operating systems, these features are often hard to use, not well documented, and only callable from assembly language. When a program makes use of these features, the program may be much more complex and much more difficult to maintain. In UNIX because the C language was written to be used to implement an operating system rather than a traditional "input-processing-output" application, use of these sophisticated features is quite easily done from the C language without writing any assembly language.

Tuesday, September 3, 2019

Cultural Event :: essays research papers

Scissors, Paper, Rock! For my first cultural event, I attended the University Performing Dancers rendition of â€Å"Scissors, Paper, Rock!†. This dance performance took place in University Hall here on campus. This performance is considered a cultural event because the game Rock, Paper, Scissors is an ancient game that many different cultures have claimed to invented.   Ã‚  Ã‚  Ã‚  Ã‚  According to the program handed out at the performance, Japan has claimed its origins in Janken or Roe, Sham, Boe (Rock, Paper, Scissors). The game is called Muk-chee Bah in Korea. Renditions of the hand game are also played in Indonesia, Austria, France, Canada, Yugoslavia, and elsewhere.   Ã‚  Ã‚  Ã‚  Ã‚  All these different cultures have claims to have invented the game, and it is such a popular game, somebody made a modern dance performance related to the certain aspects that Scissors, Paper, and Rock have. Scissors, cold, cutting, slicing. Paper, light, soft, airy. Rock, pebble, hard, stone. These are some of the adjectives the narrator used in the performance. There were six different dances in the performance, each one different in their own cultural way. Dances like â€Å"Oshun, Goddess of Love† were based on actual beliefs. Oshun is the goddess of the rivers, fertility, abundance, and love among the Yoruba people of Nigeria. The dance is a creative exploration of the meaning of Oshun as a force of nature. Other dances performed such as â€Å"Paper Moon† are attempts to shape the timelessness found in play, such as ritual, and performance.   Ã‚  Ã‚  Ã‚  Ã‚  Different dances came from different cultures in this performance. As I had said before, â€Å"Oshun, Goddess of Love†, came from Africa. It arrived in America during the slave trade and has been here ever since. â€Å"Paper Moon† came from Japan. The text from the dance came from an adaptation from â€Å"Omoiyari†, which is an ancient Japanese dance ritual.   Ã‚  Ã‚  Ã‚  Ã‚  Dance is a part of every culture. Whether it is the fire dances of the native Hawaiians, or the Tango from Spain, dance is a part of every culture. This event is not an event I would usually attend. I am not into art of any kind except music. At first, there were two reasons I went to this performance.

Monday, September 2, 2019

song of solomon :: essays research papers

When Milkman goes to Pennsylvania to look for the gold, he was actually in search of his family’s past. One of the themes in the story is how the history of African Americans histories are not clear and unrecorded. The fact that the history of Milkman’s family history is so unclear and unrecorded he goes through a long journey to find it. Along the way he goes through many places and meets many people that help him find his family history. Milkman thought the bag that Pilate had was filled with the dead white mans gold, but when he reaches Pennsylvania he realizes that he is wrong. He found out the truth when he meets ancient Circe. Ancient Circe is a woman he meets and she represents a person who is linked to Milkman’s past. She was living through the Civil War and mid-wifed Macon and Pilates birth. Circe knew his ancestors and she told Milkman that the bones in the bag were her father’s bones. All this is too much for Milkman to believe without actual proof, so he travels to Virginia in hope to find the whole truth. Before Milkman could reach where he intended on going in Virginia, his car breaks down so he went to an auto shop in Shalimar, Virginia. In Shalimar heWhen Milkman goes to Pennsylvania to look for the gold, he was actually in search of his family’s past. One of the themes in the story is how the history of African Americans histories are not clear and unrecorded. The fact that the history of Milkman’s family history is so unclear and unrecorded he goes through a long journey to find it. Along the way he goes through many places and meets many people that help him find his family history. Milkman thought the bag that Pilate had was filled with the dead white mans gold, but when he reaches Pennsylvania he realizes that he is wrong. He found out the truth when he meets ancient Circe. Ancient Circe is a woman he meets and she represents a person who is linked to Milkman’s past.

Sunday, September 1, 2019

The Three Waves of Feminism

The Three Big Waves of Feminism First-Wave Feminism: Women’s Right to Vote In 1776, the then First Lady of the United States was the first to raise her about women’s rights, telling her husband to â€Å"remember the ladies† in his drafting of new laws, yet it took more than 100 years for men like John Adams to actually do so. With the help of half a dozen determined, and in this case white upper-middle-class, women the first-wave feminism, which spans from the 19th century to the early 20th century, finally led to their goal after 72 years of protesting. The Nineteenth Amendment, which secured the rights for women to vote finally passed in 1920.This grand victory brought other reforms along, including reforms in the educational system, in healthcare and in the workplace. Second-Wave Feminism: Personal Means Political The First-Wave was significant to feminism as it established a safe footing from where women could start off. The second wave of feminism, however, was crucial to everything that followed after. This wave marked everything the early 1960's to the late 1980's. Of course feminism didn’t die out completely, in between the first and second wave feminism, as the media tried to make many people believe.In fact feminism was still a topic among women; they just didn’t crowd at polling stations anymore. Instead many small groups of women activists were fighting for birth control or the women peace movement. Then, during the Second World War women suddenly played a major role as work forces and could get a taste of independency. Though after the war, now that the men were back with their glorified heroism, it was expected of women to silently head back into the kitchen and act out their â€Å"natural† role as mother and wife, which has been pressed onto them from the very start. You can read also WavesObviously that didn’t sit well with many of them. However before the the Women’s Liberation movement and before the Sexual Revolution in 1968, there have been the Civil Rights Movement and the antiwar movement. Those two were the first two major social movements to be displayed through television, as well as they were the forerunners of the following feminist movement. They showed that women, too, could become political. Women from Rosa Parks to Coretta Scott King made political protest seem necessary and encouraged many women all over America, regardless of race and ethnic background, to speak up for their rights.It was the feminist movement’s turn then to get real personal and by getting real personal it didn’t get any less political. Women had enough of the sexual harassment and domestic violence going on behind doors, of being kept out of law and medical schools and thus being restricted to low paid jobs, of being confined not on ly in domestic but also in public spheres. To make it short: women had enough of being looked down at. With these problems the key demands of this movement were: â€Å"the right to safe and legal abortion, the right to accessible and affordable childcare, and the equal opportunities in education and employment†.Another demand was more support of battered women's shelters, and changes in custody and divorce law. This wave of feminism brought up the most of changes regarding women and laws. Affirmative Action rights for women were extended and acts like the Women’s Educational Equity Act, which allowed educational equality for women, the Pregnancy Discrimination Act, which prohibited â€Å"sex discrimination on the basis of pregnancy†, were passed. Amongst these acts a law passed in 1975 that required the U. S.Military Academies to admit women, as well as marital rape was made illegal and the no-fault divorce legal. Even though the last two laws were not recognize d by all states, it was still considered an enormous success. In the early 1980s the biggest strength of the second wave, the grand diversity of feminism and organisations, suddenly became its biggest weakness as the media started the so called â€Å"feminist sex wars† by pitting women, especially two of them, against each other, trying to destroy the image of sisterhood pointedly.Even though the Women’s Liberation movement clearly refused to pick a leader, the media singled out Gloria Steinem as the leader of this movement. Gloria Steinem was a single and childless career woman, who compared marriage to prostitution and insisted that â€Å"if men could get pregnant, abortion would be a sacrament†. On the other side there was the media’s darling Phyllis Schlafly, who almost single-handedly brought down the Equal Rights Amendment. Also known as the ERA, this mendment demanded that the â€Å"equality of rights under the law shall not be denied nor abridged by the United States or any state on the account of sex†. It was first introduced by Alice Paul in 1923, a woman truly ahead of her time, but didn’t get ratified by enough states to get legalized. Whether this happened because of Phyllis Schlafly herself or the way media presented the feminists of that time is debatable. In the end the ERA may not have gotten legalized and women were still oppressed, but sisterhood was very much alive and blooming.In sisterhood women found strength and with this new found strength they started breaking the blockades which had been keeping them from climbing the career ladder and decided that it was long past time to start taking charge of their own lives. Third-Wave Feminism: Finally Diversity After ERA was defeated, a vast amount of media coverage over the supposed â€Å"death of feminism† appeared on the TV screen of Americans. Those who truly believed them were surely gobsmacked by the third wave of feminism which found its s tart in the mid-90’s.Caused by the Clarence Thomas confirmation hearings and the evident spite and disdain the accuser, Anita Hill, was met with by the all-male jury, women decided that once men crossed one line too many. The most obvious difference between the third wave movement and its sisters the first and second wave movements was the embracement of diversity. With feminism becoming global it became available for women of any race as well as any social class, but also threw away the mass media’s â€Å"ugly braless bubblehead† stereotype of feminists with women like Pinkfloor stating: â€Å"†It's possible to have a push-up bra and a brain at the same time. Being feminine and a feminist was no longer mutually exclusive and with the so-called â€Å"grrl† feminists, women started to show up as strong and empowering, while reclaiming everything feminine, from wearing high-heels to lipstick. The key demands of the Third Wave are much harder to pin p oint, as the range of issues grew by women not only concerning themselves with the gender oppression but with economic oppression and environmental issues as well.However one crucial aspect was the deconstruction of categorical thinking and its endless attack on unrealistic beauty ideals set for women ever since television was invented. The third wave of feminism has not ended yet. It is history in the making, as new issues to deal with arise as soon as old ones are solved. The probably greatest achievement of these waves is the awareness of oppression they’ve spread, the feeling of community between women they created as well as turning feminism from an abstract thought into a widely accepted truth.

Functionalist Perspective Essay

My favorite perspective in sociology was learning about the functionalist perspective aka functionalism. I do know that it is one of the major concept theories and perspectives in sociology. From class we learned about Emile Durkheim’s interest in this theory on how social order is possible on how society remains relatively stable through functionalism. â€Å"Functionalism does interpret every part of society on how it all contributes to the stability and the survival of society†. I guess the reason why I liked the study of functionalism is for the same reason why I like to be a functional person, I love for there to be order and I believe that everybody plays a role in that sense, either they know they are playing that part unknowingly or they do know and they are part of the order. I cannot stand for dysfunctional people especially when it can have a negative impact on a group or society. For example some of the TV shows out there like the Simpsons, family guy, two an d a half men show our children how to grow up in such a family with the understanding that such a manner that being dysfunctional is normal but it’s not. Dysfunctional families carry it on to their kids and people they are around, this can be a direct result of their parents and may also be affected by addictions, such as substance abuse like drugs and alcohol. I have seen this all my life and it just kills me to be around it, not to mention everyone that knew who has been through it always make it out alive normal. I have never liked conflict so the conflict theory goes out the window for me, but we all know that there has to be conflict in order for functionalism to work. Ying and yang is how I see the big picture. Without order stability, cohesion, and consensus, or society would be in complete chaos, and we would live in an anarchy society instead of a functional one. Sociology is the study of society, and the social interaction at all variety of levels so where there is functionalism there has to be conflict theorists like Karl Marx who showed us social conflict theories are perspectives of sociology that emphasize the social, political, or material inequality of a social group, that critique the broad socio-political system, or that otherwise detract from structural functionalism and ideological conservatisms. I do have to agree with his work against the capitalist system and how there is a thing called social inequality. Like him I also agree that wealthy and being rich doesn’t always come from hard work through and achieved status, yet it comes from ascribed status. One thing I really  appreciated was in our sociology book always in every chapter they did a break down on all the theories from functionalist, conflict, feminist, and symbolic interactionist. They gave you examples what each perspective looks at compared to the other, and before I took sociology my eyes were totally closed to what I only seen for my perspective. Like when it comes to culture, you know that I ‘am very much into to culture, only because I had an opportunity to travel the world and see all the cultures out there. I can see how generations of culture can be passed down from father to son, or mother to daughter, from grandparents to grandchildren. I only wish that here in the U.S we could have a little more appreciation for keeping the culture real, and maintaining the building blocks of our own culture. I do know that we have a lot of multiculturalism here in the United States, and as a result of that we all can benefit from having this. I know firsthand only because most of us Air Force guys love cultural universals and that is good food. Just outside of my base within a mile strip we are so lucky to have amazing Tai food like (Paw Graw), Vietnamese food (Pho ha), Mexican food (Mexican Kitchen), American food (Toms Burgers), Chinese food (Mr. You’s), Greek food (Mad Greek), Korean Food (Flame Broiler), Japanese foo d (Akinas), I mean we are literally surrounded by multiculturalism and I wouldn’t have it any other way. I have to go back to the functionalist way and say that all the culture outside of my base somehow lives off of us, and we live off them. Those citizens and we in the military all have similar beliefs that binds us together and helps with the stability of our city, and my base. Through this food culture I know that it helps to unify us as a society and definitely promotes cultural solidarity. Thank you for having me as a student, and showing me what Sociology is all about, and perhaps I might take your advice and take another advanced class for one my electives. Thank you again Professor Ellington. Reference: EBSCOHOST: Marxist and Functionalist Theories http://web.ebscohost.com/ehost/detail?vid=7&sid=415d996e-d006-463cb2bcb3ca827465e7%40sessionmgr113&hid=122&bdata=JnNpdGU9ZWhvc3QtbGl2ZQ%3d%3d#db=bth&AN=5281250 Sociological Theories: A List of Sociological Theories and Frameworks http://sociology.about.com/od/Sociology101/tp/Major-Sociological-Frameworks.htm